View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_47 (Length: 201)
Name: NF14695_low_47
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_47 |
 | |
|
| [»] scaffold0187 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 37882113 - 37882295
Alignment:
| Q |
1 |
ggaacttcagtaaagagatcatagttatcaaaacacagattgtggttgcgaacttgcagtggtggatgcagtcatgaccgctactattgtgattatgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37882113 |
ggaacttcagtaaagagatcatagttatcaaaacacagattgtggttgcgaacttgcagtggtggatgcagtcatgaccgctactattgtgattatgaac |
37882212 |
T |
|
| Q |
101 |
aatgtggctgttgtaatgtgtactgcaacgtgaaatactatatctcctctcttcctccaaaagctcctgccatggggtcgacc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
37882213 |
aatgtggctgttgtaatgtgtactgcaacgtgaaatactatatctcctctcctcttccaaaatctcctgccatggggtcgacc |
37882295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 112
Target Start/End: Complemental strand, 6314 - 6264
Alignment:
| Q |
62 |
gtggatgcagtcatgaccgctactattgtgattatgaacaatgtggctgtt |
112 |
Q |
| |
|
|||| |||| ||| |||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
6314 |
gtggttgcaatcaagaccgctactattgtgattatgaacattgtggttgtt |
6264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University