View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14695_low_5 (Length: 508)
Name: NF14695_low_5
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14695_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 390 - 495
Target Start/End: Original strand, 21144596 - 21144701
Alignment:
| Q |
390 |
attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaataactgtttggattaaaatcctaagtttaccagtt |
489 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21144596 |
attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaagaactgtttggattaaaatcctaagtttaccagtt |
21144695 |
T |
 |
| Q |
490 |
catgtc |
495 |
Q |
| |
|
|||||| |
|
|
| T |
21144696 |
catgtc |
21144701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University