View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14696_low_13 (Length: 251)
Name: NF14696_low_13
Description: NF14696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14696_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 50184697 - 50184452
Alignment:
| Q |
8 |
tcgaagaatataaaa--gagattttaatagggatgacttaagtctgcaatttgggtggggacatcaggattttcaatgtctctcaactccagtgcaacct |
105 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50184697 |
tcgaataatataaaatagagattttaatagggatgacttaagtctgcaatttgggttgggacatcaggattttcaatgtctctcaactccagtgcaacct |
50184598 |
T |
 |
| Q |
106 |
caactgaggcacttcaaacacatttgacggtgaacctcagaagaaagccaaatttcgtattcataattttgttcaaatacagaccaaaattcacaaaacg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
50184597 |
caactgaggcacttcaaacacatttgacggtgaacctcagaagaaagccaaatttcgtattcataattttgttcaaatacagaccaaaattcacaaaatg |
50184498 |
T |
 |
| Q |
206 |
gcaatggttaaatcccttcatatatggtgcataagaatttggaaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50184497 |
gcaatggttaaatcccttcatatatggtgcataagaatttggaaat |
50184452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University