View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14696_low_14 (Length: 249)

Name: NF14696_low_14
Description: NF14696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14696_low_14
NF14696_low_14
[»] chr8 (1 HSPs)
chr8 (167-233)||(43803077-43803144)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 167 - 233
Target Start/End: Complemental strand, 43803144 - 43803077
Alignment:
167 ttataaacaaaggaaacaaatagaaaa-gtgattctcattactcaattatggaaagtacaagatgtat 233  Q
    |||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
43803144 ttatgaacaaaagaaacaaatagaaaaagtgattctcattactcaattatggaaagtacaagatgtat 43803077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University