View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14696_low_18 (Length: 206)
Name: NF14696_low_18
Description: NF14696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14696_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 38521042 - 38521213
Alignment:
| Q |
17 |
atcataaaacaaggcagaactgatattgctaagcatatgaaatgattatgagaaccagttatcagttatcacggcttagcagagaaaggtgatacatcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38521042 |
atcataaaacaaggcagaactgatattgctaagcatatgaaatgattatgagaaccagttatcagttatcacggcttagcagagaaaggtgatacatcta |
38521141 |
T |
|
| Q |
117 |
acattgaacatttatttcggtaacgaaaatatcctgtctgtcacaattgaaaacgaacaaaaacttgaacat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38521142 |
acattgaacatttatttcggtaacgaaaatatcctgtctgtcacaattgaaaacgaacaaaaacttgaacat |
38521213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University