View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14696_low_5 (Length: 358)
Name: NF14696_low_5
Description: NF14696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14696_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 14 - 341
Target Start/End: Complemental strand, 48767368 - 48767028
Alignment:
| Q |
14 |
aagaatatacaggaaacagatcaaaactcgtcatgatcctgttaaatagagttgttgtatcagtatcacatacataatttgtagctaggaaaaatttgta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767368 |
aagaatatacaggaaacagatcaaaactcgtcatgatcctgttaaatagagttgttgtatcagtatcacatacataatttgtagctaggaaaaatttgta |
48767269 |
T |
 |
| Q |
114 |
gctagtaattattactgctacatctaaacatggttccttgtcgtcatttgttgttcttagggttagttattttagtctaacgcaatataaacttaattat |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48767268 |
gctagtaattactactgctacatctaaacatggttccttgtcgtcatttgttgttcttagggttagttattttagtctaacgcaatataaactgaattat |
48767169 |
T |
 |
| Q |
214 |
ggcttgtatatgagtaattatgagaaat-------------tatgttcacttgcaaattgcaactttaaaccgatcaacacaattatgtgccgaaacttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767168 |
ggcttgtatatgagtaattatgagaaatatgcattgatgtatttgttcacttgcaaattgcaactttaaaccgatcaacacaattatgtgccgaaacttg |
48767069 |
T |
 |
| Q |
301 |
tcatgaacaaaggttcggattggtaaaaagtagctgatgat |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48767068 |
tcatgaacaaaggttcggattggtaaaaagtagcggatgat |
48767028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University