View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14698_low_10 (Length: 238)
Name: NF14698_low_10
Description: NF14698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14698_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 1892416 - 1892622
Alignment:
| Q |
16 |
tgaactatactttttataaccttactgattctttctgaaccaaactgtttcaaattgcttccaaaaccaatccaaattgaatgtcagagttgtttataaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1892416 |
tgaactatactttttataaccttactgattctttctgaaccaaactgtttcaaattgcttccaaaaccaatccaaattgaatgtcagagttgtttataaa |
1892515 |
T |
 |
| Q |
116 |
agtact-nnnnnnnncgaaccgaatgacactgaaaagaactgaatcgttacagatagttcacaagctgaacctgttcaatttgtgaactgtcagtcacag |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1892516 |
agtactaaaaaaaaacgaaccgaatgacactgaaaagaactgaattgttacagatagttcacgagctgaacctgttcaatttgtgaactgtcagtcacag |
1892615 |
T |
 |
| Q |
215 |
ttcagtt |
221 |
Q |
| |
|
||||||| |
|
|
| T |
1892616 |
ttcagtt |
1892622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University