View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14698_low_11 (Length: 234)
Name: NF14698_low_11
Description: NF14698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14698_low_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 44754463 - 44754247
Alignment:
| Q |
18 |
ccgttttgttcaagaaacttgaagcacaaccatttactttagaacttgatgaaggcaatgaagtagaagaaacttgaaacatctcagcccatttcatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44754463 |
ccgttttgttcaagaaacttgaagcacaaccatttactttagaacttgatgaaggcaatgaagtagaagaaacttgaaacatctcagcccatttcatttt |
44754364 |
T |
|
| Q |
118 |
ctgactcaaattttctcctgtactttgattttgattcccttgattggcggtgtttccgataagcgaagaaagtgctgcagctaaagctgattgaaaagtt |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44754363 |
ctgactcaaattttctcctgcactttgattttgattcccttgattggtggtgtttccgataagcgaagaaagtgctgcagctaaagctgattgaaaagtt |
44754264 |
T |
|
| Q |
218 |
ggatctgctgtgatagc |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44754263 |
ggatctgctgtgatagc |
44754247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University