View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14698_low_14 (Length: 217)
Name: NF14698_low_14
Description: NF14698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14698_low_14 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 14764 - 14548
Alignment:
| Q |
1 |
ataactaaaacaaacaatcaacaatgaatatcaaaataacatgaacaacttataatttaaactacactatattgactttgaaacaccaattaaaatcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14764 |
ataactaaaacaaacaatcaacaatgaatatcaaaataacatgaacaacttataatttaaactacactatattgactttgaaacaccaattcaaatcaat |
14665 |
T |
 |
| Q |
101 |
cttaccacgacactgggacataaaattttcttaatcagctttgagtctccacccatatgcagcacgttccatattcttctattaggtgttatcttcgtca |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14664 |
cttaccacaacactgggacataaaattttcttaatcagctttgactctccacccatatgcagcacgttccatattcttctattaggtgttatattcgtca |
14565 |
T |
 |
| Q |
201 |
agaatataataaacaaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14564 |
agaatataataaacaaa |
14548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University