View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14698_low_4 (Length: 291)

Name: NF14698_low_4
Description: NF14698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14698_low_4
NF14698_low_4
[»] chr5 (1 HSPs)
chr5 (1-237)||(12043093-12043327)
[»] scaffold0196 (1 HSPs)
scaffold0196 (3-272)||(30004-30271)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 12043093 - 12043327
Alignment:
1 tgttgaatctcatattgtttctacaccaccagattgcatttaaaatattaatgactgcataagaaagaactaacttgccttggggactccatcctctttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |||||||||| ||||||||||||||||||||||    
12043093 tgttgaatctcatattgtttctacaccaccagattgcatttaaaatgttaatgactgcataagcaataactaacttgtcttggggactccatcctctttt 12043192  T
101 gcaaatctcaaagatggataaaattgaagttaggttgagatttaagttgattaagctgctaagccagttccacaaagtcatagagaaagaacattggagg 200  Q
    ||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| | |||||||    
12043193 gcaaatctca--gatggataacattgaagttaggttgagatttaagttgattaagctgctaagacagttccacaaagtcatggagaaagagcgttggagg 12043290  T
201 aagagatgctatgaagtttcaggttgcttgttgcaca 237  Q
    |||||||||||||||||||||||||||||||||||||    
12043291 aagagatgctatgaagtttcaggttgcttgttgcaca 12043327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0196 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: scaffold0196
Description:

Target: scaffold0196; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 3 - 272
Target Start/End: Complemental strand, 30271 - 30004
Alignment:
3 ttgaatctcatattgtttctacaccaccagattgcatttaaaatattaatgactgcataagaaagaactaacttgccttggggactccatcctcttttgc 102  Q
    ||||||||| ||||||||||||||||||| ||| |||||| ||| ||||||||||||  || || ||||||| | |||||  ||||||||||||| ||||    
30271 ttgaatctcttattgtttctacaccaccatattacatttagaatgttaatgactgcagcagcaataactaacataccttgctgactccatcctctcttgc 30172  T
103 aaatctcaaagatggataaaattgaagttaggttgagatttaagttgattaagctgctaagccagttccacaaagtcatagagaaagaacattggaggaa 202  Q
    |||||||||| ||||| || | |||||| || ||||| |||||||||||||| |||| |||||| ||||||| ||  | ||||||||  || |  |||||    
30171 aaatctcaaatatggacaacactgaagtgagattgaggtttaagttgattaaactgcaaagccaattccacagagataaagagaaagggcaattaaggaa 30072  T
203 gagatgctatgaagtttcaggttgcttgttgcacaagctgcacatattgatgggaaagataagcctctga 272  Q
     ||||||| ||||||||| ||||| || |||||||||||  ||| ||||||||||||||||| |||||||    
30071 aagatgctttgaagtttctggttgtttattgcacaagct--acacattgatgggaaagataaacctctga 30004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University