View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_high_41 (Length: 227)
Name: NF1469_high_41
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 26857865 - 26858066
Alignment:
| Q |
10 |
gagatgaagcttgatgatggagttgtgacatggttttgggtaaagaacgagacgaatcaaagagttgtgtatagagaagttgtggttaagagtggtgaag |
109 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
26857865 |
gagaagaagctcgatgatggaattgtgacatggttttgggtaaagaatgagacgaatcaaagagttgtgtatagagaagtcgtggttaaaagtggtgaag |
26857964 |
T |
|
| Q |
110 |
aaacaattgcagcaattgatgatatgaaagatggtggttatgatcttttgataattggaaggaaacaagggattaacccttctcttcttacagggttatc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26857965 |
aaacaattgcagcaattcatgatatgaaagatgttggttatgatcttttgatagttggaaggaaacaagggattaacccttctcttcttacagggttatc |
26858064 |
T |
|
| Q |
210 |
tg |
211 |
Q |
| |
|
|| |
|
|
| T |
26858065 |
tg |
26858066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University