View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_high_43 (Length: 226)
Name: NF1469_high_43
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 5295034 - 5295257
Alignment:
| Q |
1 |
catgacaatgaagccaagtaaatctgactcaaatgtgaaaaagacata--cggaatctcacaactggtcagacaaaaccaaaatagttagacaaacaaag |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5295034 |
catgacaatgaagccaagtaaatctgactcaaatgtgaaaaagacatatacggaatctcacaactggtcagacaaaaccaaaatagttagacaaacaaag |
5295133 |
T |
|
| Q |
99 |
atttgcctctccactgttccatc-tgtttcacgaatattgcagcatctttgttttcttctctgaat-aatttattaaaaagtgaaacaaaattctcacgt |
196 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5295134 |
atttgcctctccactgttccatcgtgtttcacgaatattgcagcatctttgttttcttctctgaataaatttattaaaaagtgaaacaaaattctcacgt |
5295233 |
T |
|
| Q |
197 |
tttatcacataaacatcaatgaag |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5295234 |
tttatcacataaacatcaatgaag |
5295257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University