View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_high_46 (Length: 215)
Name: NF1469_high_46
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_high_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 39090553 - 39090356
Alignment:
| Q |
1 |
agagcaaagtcttggaaacctctcctgcaaaataattgaatttccagcccatctttgagaccaaaacaatgtcgtctaaccattaccaatcctacaaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090553 |
agagcaaagtcttggaaacctctcctgcaaaataattgaatttccagcccatctttgagaccaaaacaatgtcgtctaaccattaccaatcctacaaacc |
39090454 |
T |
|
| Q |
101 |
accggattagagaacaaattagtgctggctgggtgagcagtgtcaattaacttcaaaccatgccactaaattgaatccctgctacttgatgtaattga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090453 |
accggattagagaacaaattagtgctggctgggtgagcagtgtcaattaacttcaaaccatgccactaaattgaatccctgctacttgatgtaattga |
39090356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 39081178 - 39080994
Alignment:
| Q |
11 |
cttggaaacctctcctgcaaaataattgaatttccagcccatctttgagaccaaaacaatgtcgtctaaccattaccaatcctacaaaccaccggattag |
110 |
Q |
| |
|
|||||||| || |||||||||||| |||||| ||||||| || |||||||||||||||||||||| |||||| ||||||||| |||||||| ||||| |
|
|
| T |
39081178 |
cttggaaatctgtcctgcaaaata---gaattttcagcccacctatgagaccaaaacaatgtcgtctcaccattgccaatcctatgaaccaccgaattag |
39081082 |
T |
|
| Q |
111 |
agaacaaattagtgctggctgggtgagcagtgtcaattaacttcaaaccatgccactaaattgaatccctgctacttgatgtaattga |
198 |
Q |
| |
|
|||||| |||||||| |||||||||||||| |||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
39081081 |
agaacatattagtgcaggctgggtgagcagagtcaattaacttcaaatcatgccaccaaattgaatccatgctacttgatgtaattga |
39080994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University