View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_high_49 (Length: 208)
Name: NF1469_high_49
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_high_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 7937801 - 7937619
Alignment:
| Q |
12 |
ttattcttggaaggccttgataatattatcgtcgtgccttatataacgattataccaacacatcacttttgtgaaagatgagattaaaatcaagttatca |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7937801 |
ttattcttggaaggccttaataatattatcgtcgtgccttatataacgattataccaacacatcacttttgtgaaggatgagattaaaatcaagttatca |
7937702 |
T |
 |
| Q |
112 |
ccactaccaccaatcg-attccatgaagagaaaacgaagcaaggcaacaagtacatttggtcacaagaaagtcagtatgtagt |
193 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7937701 |
ccactaccagcaatcgaattacatgaagagaaaacgaagtatggcaacaagtacatttggtcacaagaaagtcagtacgtagt |
7937619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 107
Target Start/End: Complemental strand, 42679301 - 42679209
Alignment:
| Q |
16 |
tcttggaaggccttgataatattatcgtcgtgccttatataacgattataccaaca-catcacttttgtgaaagatgagattaaaatcaagtt |
107 |
Q |
| |
|
|||||| ||||| || ||||| ||| |||||| |||||| | | ||||||||||| || ||||||||||||| ||| |||||||||||||| |
|
|
| T |
42679301 |
tcttgggaggccatggcaatatgatcatcgtgcattatatgatggttataccaacatcaacacttttgtgaaatatggtattaaaatcaagtt |
42679209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University