View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_high_9 (Length: 418)
Name: NF1469_high_9
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 1329433 - 1329669
Alignment:
| Q |
11 |
aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329433 |
aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca |
1329532 |
T |
 |
| Q |
111 |
tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329533 |
tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa |
1329632 |
T |
 |
| Q |
211 |
tgaagtcaaggcccttccaccaccagaggaaccagcc |
247 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1329633 |
tgcagtcaaggcccttccaccaccagaggaaccagcc |
1329669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 297 - 400
Target Start/End: Original strand, 1329719 - 1329822
Alignment:
| Q |
297 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaacttgccttagctttatttgatggggctgc |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1329719 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgc |
1329818 |
T |
 |
| Q |
397 |
acca |
400 |
Q |
| |
|
|||| |
|
|
| T |
1329819 |
acca |
1329822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University