View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_low_20 (Length: 313)
Name: NF1469_low_20
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 150 - 301
Target Start/End: Original strand, 39849417 - 39849568
Alignment:
| Q |
150 |
atctatggcaagaattaagattcgtacatcttaaatgtgaagaagtgatgaatctcgagttcggacctaaatcctttcatatcaacattttttgcattta |
249 |
Q |
| |
|
||||||| |||||||||||||| | ||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| || |
|
|
| T |
39849417 |
atctatgtcaagaattaagatttgcacaccttaaatgtgaagaagtgatgaatctcgagttcgaacgtaaatcctttcatatcaacattttttgcatcta |
39849516 |
T |
 |
| Q |
250 |
tcaattgaattgtacttgtgagactaacttaaattcttttaataatgatttt |
301 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39849517 |
tcaactgaattgtacttgtgagactaaattaaattcttttaataatgatttt |
39849568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 39848981 - 39849036
Alignment:
| Q |
67 |
ctttattgaacatattagatgttgatactttccggatatgttatgcaaagtttaat |
122 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39848981 |
ctttattgaacatattagacgttgatactttccggaaatgttatgcaaagtttaat |
39849036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 39847647 - 39847679
Alignment:
| Q |
18 |
aacttgaccacaaaatcagaagaatatttgaat |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39847647 |
aacttgaccacaaaatcagaagaatatttgaat |
39847679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University