View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1469_low_50 (Length: 227)
Name: NF1469_low_50
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1469_low_50 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |
|
| [»] scaffold0429 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 29017 - 29243
Alignment:
| Q |
1 |
ggagttatggggtttgaattctgctactaacaagtccctctccccttaacatatcaactactaacattagcctgaaaaataatcatcaattatgctattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29017 |
ggagttatggggtttgaattctgctactaacaagtccctctccccttaacatatcaactactaacatttgcctgaaaaataatcatcaattatgctattg |
29116 |
T |
 |
| Q |
101 |
attcagcagatgctccttttactnnnnnnngactcaaagatttagacattaagtagctgcagcatagatatagcagaccaaaatgacattatatttgcgc |
200 |
Q |
| |
|
||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29117 |
attcagcagatgctccttttactaaaaaaagattcaatgatttagacattaagtagctgcagcatagatatagcagatcaaaatgacattatatttgcgc |
29216 |
T |
 |
| Q |
201 |
ttaaattatattcaaaagacataatat |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
29217 |
ttaaattatattcaaatgacataatat |
29243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0429 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: scaffold0429
Description:
Target: scaffold0429; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 9927 - 9830
Alignment:
| Q |
17 |
aattctgctactaacaagtccctctccccttaacatatcaactactaacattagcctgaaaaataatcatcaattatgctattgattcagcagatgct |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||| ||||||| |||| |||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
9927 |
aattctgctactaacaggtccctctccccctaacgtatcaactattaacatttgcctcaaaaataatcatcagttatgctattgattcttcagatgct |
9830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University