View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1470-Insertion-10 (Length: 467)
Name: NF1470-Insertion-10
Description: NF1470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1470-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 8 - 467
Target Start/End: Complemental strand, 31471645 - 31471186
Alignment:
| Q |
8 |
aaggccactggcgacccttattgtaccctttttgtgggtcgtctttctcgactcaccactgaagaaactctccgaaaggtagtatgaattgtccgtacca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31471645 |
aaggccactggcgacccttattgtaccctttttgtgggtcgtctttctcgactcaccactgaagaaactctccgaaaggtagtatgaattgtccgtacca |
31471546 |
T |
|
| Q |
108 |
actaagctatgctcaccacttcnnnnnnngcttcattatgttctttagcatcttgatttttgtgatgtgtgggttttatcttttcaggttatgagtgagt |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31471545 |
actaagctatgctcaccacttctttttttgcttcattatgttctttagtatcttgatttttgtgatgtgtgggttttatcttttcaggttatgagtgagt |
31471446 |
T |
|
| Q |
208 |
ttggtcaggtgaagaacttgcgcttggtgagggacattggtaaataaatttctttggtctatcttaattttttaacagtctattatttcagattttgtca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31471445 |
ttggtcaggtgaagaacttgcgcttggtgagggacattggtaaataaatttctttggtctatcttaattttttaacagtctattatttcagattttgtca |
31471346 |
T |
|
| Q |
308 |
gttatttccccccttactattatacatcttcaaacagtgtgtttttgctaaacatttaatggttgaacttgcggatcgatacaattgagtgcttgcatga |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31471345 |
gttatttccccccttactattatacatcttcaaacagtgtgtttttgctaaacatttaatggttgaacttgcggatcgatacaattgagtgcttgcatga |
31471246 |
T |
|
| Q |
408 |
ttctctgaacttgattgtgtttttgaaaaataacatttcattgaagaatatgttctcttc |
467 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31471245 |
ttctctgaacttgattgtgtttttgaaaaataacatttcattgaagaatatgttctcttc |
31471186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University