View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14700_low_3 (Length: 243)
Name: NF14700_low_3
Description: NF14700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14700_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 21844529 - 21844309
Alignment:
| Q |
4 |
aacacagattaaaggtgtgacagtaatgtcttgaggtaaggtttgtatcgttcattgtagtcttactcgattcaaacgaaaaggatgtggtagtggttaa |
103 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21844529 |
aacaaagattaaaggtgtgacagtagtgtcttgaggtagggtttgtatcgtccattgtagtcttactcgattcaaacgaaaaggatgtggtagtggttca |
21844430 |
T |
 |
| Q |
104 |
atttcaaccactagtattataaccttatctggggcatagaaattttaatttgtattgtagcatttaaatttttcaaattgtttcctaattttagctataa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21844429 |
atttcaaccactagtattataaccttatctggggcatagaaattttaatttgtattgtagcatttaaatttttcaaattgtttcctatttttagctataa |
21844330 |
T |
 |
| Q |
204 |
ctatgcaaatatcacccaata |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21844329 |
ctatgcaaatatcacccaata |
21844309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University