View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_high_12 (Length: 343)
Name: NF14702_high_12
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_high_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 17 - 343
Target Start/End: Complemental strand, 43742793 - 43742467
Alignment:
| Q |
17 |
agtcctccaccaccttctctttcactttgcnnnnnnnnctttccaaaacaacaatgatggcgacaaagatctcaactcccttgatgagcttggagattcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43742793 |
agtcctccaccaccttctctttcactttgcaaaaaagactttccaaaacaacaatgatggcgacgaagatctcaactcccttgatgagcttggagattcc |
43742694 |
T |
 |
| Q |
117 |
tccaccacttcgacgacaacgatgaaggggacaacgactttggcaacttgtccggcttggaccatcacatagaagacgagttcaagtagcaagaaatgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43742693 |
tccaccacttcgacgacaacgatgaaggggacaacgactttggcaacttgtccggcttggaccatcacatagaagacgagttcaagtagcaagaaatgaa |
43742594 |
T |
 |
| Q |
217 |
ggaaaaagatgttgtcgttttgaaggagcaaaactttactagtgtaattgaaaagaaccaattccttatggttgagttctattctcacgggtgtggtcgc |
316 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||| | |
|
|
| T |
43742593 |
ggaaaaagacgttgtcgttttgaaggagcaaaactttaccagtgtaattgaaaagaaccaattccttatggttgagttctatgctccctggtgtggtcac |
43742494 |
T |
 |
| Q |
317 |
tctcaagctctggtgctggagtatgct |
343 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43742493 |
tctcaagctctggtgctggagtatgct |
43742467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 291
Target Start/End: Original strand, 21886064 - 21886134
Alignment:
| Q |
221 |
aaagatgttgtcgttttgaaggagcaaaactttactagtgtaattgaaaagaaccaattccttatggttga |
291 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||| ||||||||||| ||||||||| | |||||||| |
|
|
| T |
21886064 |
aaagatgttgtcgttttgattgagcgaaacttcactaccgtaattgaaaacaaccaattcgtgatggttga |
21886134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University