View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_high_19 (Length: 302)
Name: NF14702_high_19
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 36522342 - 36522119
Alignment:
| Q |
12 |
catcatcatgggctttttccaatgctttggtaagaaggaactattaacattgaagttagtgtaaagtgggctgtgaaagatcatgtatacttgtactttt |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
36522342 |
catcatcatgggctttttccaatgttttggtaagaaggaactattagcattgaagttagtgtaaagtgggttgtgaaagatcatgtatacttgttctttt |
36522243 |
T |
|
| Q |
112 |
tggtcctagaatagcgttatttgaatgtgtaaagggatttgaggaccaaaaaagtgggaatctgtcaacatatattggaagatacgttaagggttagcaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522242 |
tggtcctagaatagcgttatttgaatgtgtaaagggatttgaggaccaaaaaagtgggaatatgtcaacatatattggaagatacgttaagggttagcaa |
36522143 |
T |
|
| Q |
212 |
taaatggaagctttaagttgattg |
235 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
36522142 |
taaattgaagctttaagttgattg |
36522119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University