View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_high_24 (Length: 258)
Name: NF14702_high_24
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_high_24 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 50712939 - 50713179
Alignment:
| Q |
18 |
tgccataattcttgatacnnnnnnntcaactattactgaaaaaactcaatatgaaattacccttttgctagcagctatagcatttggacaagaatttctt |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50712939 |
tgccataattcttgatacaaaaaaatcaactattactgaaaaaactcaatatgaaattacccttttgctagcagctatagcatttggacaagaatttctt |
50713038 |
T |
 |
| Q |
118 |
cttttccatcttcattcaagaagtcacatggggatagaaggacaataccattattgtttgcaagttttgattatgataggttttgttacaacccttatgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50713039 |
cttttccatcttcattcaagaagtcacatggggatagaaggacaataccattattgtttgcaagttttgattatgataggtttttttacaacccttatgg |
50713138 |
T |
 |
| Q |
218 |
gaattggttttccaaagagttttttggtatgttttcttcgt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50713139 |
gaattggttttccaaagagttttttggtatgttttcttcgt |
50713179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 58 - 245
Target Start/End: Original strand, 50718260 - 50718447
Alignment:
| Q |
58 |
aaaactcaatatgaaattacccttttgctagcagctatagcatttggacaagaatttcttcttttccatcttcattcaagaagtcacatggggatagaag |
157 |
Q |
| |
|
|||| |||| |||||||||||| |||||||||||| |||||||||| |||| ||||||||||| | ||||| |||||||| ||||||||| ||||||| |
|
|
| T |
50718260 |
aaaagtcaaaatgaaattacccatttgctagcagcaatagcatttgcacaacaatttcttcttattcatctccattcaagggatcacatgggtatagaag |
50718359 |
T |
 |
| Q |
158 |
gacaataccattattgtttgcaagttttgattatgataggttttgttacaacccttatgggaattggttttccaaagagttttttggt |
245 |
Q |
| |
|
||||||| ||||||| | |||||||||||| ||| ||||||| |||||||||||||||||||||| ||||| ||| || ||||| |
|
|
| T |
50718360 |
gacaatatcattatttactacaagttttgatttcgatttgttttgtgacaacccttatgggaattggttatccaatgagcttcttggt |
50718447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University