View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_low_20 (Length: 310)
Name: NF14702_low_20
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 156 - 309
Target Start/End: Complemental strand, 34572766 - 34572613
Alignment:
| Q |
156 |
atctcaatggcttgtgttgtgcataatcagggaagattctccttacaatttctcttcattataaggaccatgtttcttttatgaatcataagcattctcc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572766 |
atctcaatggcttgtgttgtgcataatcagggaagattctccttacaatttctcttcattataaggaccatgtttcttttatgaatcataagcattctcc |
34572667 |
T |
|
| Q |
256 |
aaactcaactgcttcaattaaggactcaacagaatctgaacgtcgtcacatttc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34572666 |
aaactcaactgcttcaattaaggactcaacagaatctgaacgtcttcacatttc |
34572613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 34572920 - 34572825
Alignment:
| Q |
1 |
ctgttgaattgaacttatttccatcactatttagcatttatttttactttatgtacactgttttctgaaggtttaaccatagtttttaatttcttg |
96 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572920 |
ctgttgaattgaacttatttccattactatttagcatttatttttactttatgtacactgttttctgaaggtttaaccatagtttttaatttcttg |
34572825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University