View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_low_30 (Length: 248)
Name: NF14702_low_30
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 31870093 - 31869956
Alignment:
| Q |
1 |
gactgtaatggtgtgtttaattcataaaacaagtgtgggatagaacactgcatgacatgataagacaaaacaagacaaaatagatcatattttttatagt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870093 |
gactgtaatggtgtatttaattcataaaacaagtgtgggatagaacactgcatgacatgataagacaaaacaagacaaaatagatcatattttttatagt |
31869994 |
T |
|
| Q |
101 |
atgttgaaaaataaaaagggtattttgatatattttag |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869993 |
atgttgaaaaataaaaagggtattttgatatattttag |
31869956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 130 - 248
Target Start/End: Complemental strand, 31869604 - 31869486
Alignment:
| Q |
130 |
atattttagtcccataatttagtgagagaccaaaattatcgtgtttgtcgaatcacttgctannnnnnngttcagtttcttgacaagtttctaaatggct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||| ||| |
|
|
| T |
31869604 |
atattttagtcccataatttagtgagagaccaaaattattgtgtttgtcgaatcacttgctatttttttgttcagtttcttaacaagtttctaaatagct |
31869505 |
T |
|
| Q |
230 |
taattgcacttttggaccc |
248 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31869504 |
taattgcacttttggaccc |
31869486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 134
Target Start/End: Original strand, 42250219 - 42250253
Alignment:
| Q |
100 |
tatgttgaaaaataaaaagggtattttgatatatt |
134 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42250219 |
tatgttggaaaataaaaagggtattttgatatatt |
42250253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University