View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_low_34 (Length: 240)
Name: NF14702_low_34
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 25655899 - 25656126
Alignment:
| Q |
1 |
atgtcaattaatgaataacctatggtattatatttatttatagaaaaagagcttgtaaaaggttgttcatatattatatcctctcaactgaaagtgatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25655899 |
atgtcaattaatgaataacctatggtattttatttatttatagaaaaagagcttgtaaaaggttgttcatatattatatcctctcaactgaaagtgatta |
25655998 |
T |
 |
| Q |
101 |
tatcatattg-----caattaaattgtattattatacttgtactgatatata----attgaaatgtgatatcctatcaagatgagagtaatcgaaacaat |
191 |
Q |
| |
|
|||||||||| |||| |||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25655999 |
tatcatattgtacatcaatcaaattgtattattacacttgtactgatgtataatatattgaaatgtgatatcctatcaagatgagagtaatcgaaacaat |
25656098 |
T |
 |
| Q |
192 |
ctctaattttgtatcacacatatacaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25656099 |
ctctaattttgtatcacacatatacaaa |
25656126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University