View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_low_35 (Length: 238)
Name: NF14702_low_35
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 26 - 221
Target Start/End: Complemental strand, 36521623 - 36521428
Alignment:
| Q |
26 |
atattatgatataaattctattatgtgtttgattcgtacttgataaaaattatgatttcattcttttaccatgtcatacatttggtatactatttgatga |
125 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36521623 |
atattatgatataaattatattatgtgtttgattcgtacttgataaaaattatgatttcattcttttaccatgtcatacatttggtatactatttgatga |
36521524 |
T |
|
| Q |
126 |
tgaaaaagaatttattagtgaccacaatatgaatacaatgacgtccaatatttacccttataagctgataaaattcttttcattactaaagagttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36521523 |
tgaaaaagaatttattagtgaccacaatatgaatacaatgacgaccaatatttacccttataagctgataaaattcttttcattactaaagagttt |
36521428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University