View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14702_low_36 (Length: 236)
Name: NF14702_low_36
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14702_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 29955057 - 29955277
Alignment:
| Q |
1 |
tcacaggttcaacggactttggcaaaacaaaatcatgattgagattctctggctcttcatgcatgacggttgcagtgtcatcgttcttactgcgaataat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29955057 |
tcacaggttcaacagactttggcaaaacaaaatcatgattgagattctccggctcttcatgcatgatggttgcagtgtcatcgttcttactgcgaataat |
29955156 |
T |
|
| Q |
101 |
cgattttggattcttaacggtttgaacaacctctgtgattgaacccatagcttcctccttttgacgagctagcaaatgagaaattacacgattacatgtg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29955157 |
cgattttggattcctaacggtttgaacaacctctgtgattgaacccatagcttcctccttttgacgagctagcaaatgagaaattacacgattacatgtg |
29955256 |
T |
|
| Q |
201 |
aagttggaaccatcatcacac |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
29955257 |
aagttggaatcatcatcacac |
29955277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University