View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14703_high_13 (Length: 227)
Name: NF14703_high_13
Description: NF14703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14703_high_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 3954765 - 3954983
Alignment:
| Q |
9 |
ttttaccctccaataccggaaaatcgaacagggaaaggagagagaagcttaagagaagccataagacgagaagcgatggaatcaccggaaacctcgccgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3954765 |
ttttaccctccaataccggaaaatcgaacagggaaaggagagagaagcttaagagaagccataagacgagaagcgatggaatcaccggaaacctcgccgg |
3954864 |
T |
|
| Q |
109 |
caacaataaaaaccctaaattcgccatctcttgcagccatatccattggagctttgaacttggcgtgatgtgaagatgaaaaagaagaagaaaaggttaa |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3954865 |
caacaacaaaaaccctaaattcgccatctcttgcagccatatccattggagctttgaacttggcgtgatgtgaagatgaaaaagaagaagaaaaggttaa |
3954964 |
T |
|
| Q |
209 |
aagagtgtttggtgaattc |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3954965 |
aagagtgtttggtgaattc |
3954983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University