View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14703_high_8 (Length: 289)
Name: NF14703_high_8
Description: NF14703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14703_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 3962930 - 3963052
Alignment:
| Q |
1 |
aagagcaataagtataacaaagagaagcaacgccccaatgaaaacagcagccaaaatatgtggttttaggtcattttttgaattcaaatcacctacgtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
3962930 |
aagagcaataagtataacaaagagaagcaacaccccaatgaaaacagcagccaaaatacgtggttttagattattttttgaattcaaatcacctacgtgt |
3963029 |
T |
|
| Q |
101 |
atcttttacctcttttaatttaa |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3963030 |
atcttttacctcttttaatttaa |
3963052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 115 - 274
Target Start/End: Original strand, 3963439 - 3963598
Alignment:
| Q |
115 |
ttaatttaaataagtgatctttacataaattaagtccctttttaatgtcttttcttggatttcttcatcgtagtgcggtgttgttattttctttgtctta |
214 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3963439 |
ttaatttaaataggtgatctttaaataaattaagtccctttttaatgtcttttctaggatttcttcatcgtagtgcggtgttgttattttctttgtctta |
3963538 |
T |
|
| Q |
215 |
tgtgggtctttgnnnnnnnnnnnnnatcttgccgcggtgttcattttgttctgacgaacc |
274 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3963539 |
tgtgggtctttgtttttttttttttatcttgctgcggtgttcattttgttctgacgaacc |
3963598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University