View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14703_high_9 (Length: 265)
Name: NF14703_high_9
Description: NF14703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14703_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 257
Target Start/End: Original strand, 47183770 - 47184013
Alignment:
| Q |
14 |
agatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggtacatttatattgcctta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47183770 |
agatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgtttggttatgatattggtatttcaggtacatttatatagcctta |
47183869 |
T |
|
| Q |
114 |
ttctaaaggtttttgttctgattttgtatttatacgttcttatgatattggtaacttgagatcaaattctaactagatcaatctatgttcaaattttatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47183870 |
ttctaaaggtttttgttctgattttgtacttatacgttcttatgatattggtaacttgagatcaaattctaactagatcaatctatgttcaaattttatt |
47183969 |
T |
|
| Q |
214 |
tatcttatgaccaaaactccataatacctaaaaccatttacctt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47183970 |
tatcttatgaccaaaactccataatacctaaaaccatttacctt |
47184013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 101
Target Start/End: Original strand, 47196681 - 47196745
Alignment:
| Q |
37 |
tcttgcattatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggtacatt |
101 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
47196681 |
tcttgcatcatggctgctactggtggtcttatgtttggttatgatgttggtatttcaggtacatt |
47196745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 751544 - 751491
Alignment:
| Q |
43 |
attatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggt |
96 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||| ||||| |||||||| |
|
|
| T |
751544 |
attatggctgctaccggtggtcttatgttcggttatgatgttggtgtttcaggt |
751491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University