View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14703_low_16 (Length: 214)
Name: NF14703_low_16
Description: NF14703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14703_low_16 |
 |  |
|
| [»] scaffold0386 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0386 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 15411 - 15593
Alignment:
| Q |
19 |
caattaaataaaagtttgttttttgaaaaagtctatttgatttaaataggggttaatttttactattagagtcggatctccaattttctagaaacgacct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15411 |
caattaaataaaagtttgttttttgaaaaagtctatttgatttaaataggggctaatttttactattagagtcggatctccaatttcctagaaacgacct |
15510 |
T |
 |
| Q |
119 |
cacacacacatgtgtgtgtgttaagcaaattagtctaaagaccccgcgacacatacggataattgggtctcttaagcatattg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15511 |
cacacacacatgtgtgtgtgttaagcaaattagtctaaagaccccgcgacacatacggataattgggtctcttaagcatattg |
15593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University