View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14703_low_7 (Length: 300)
Name: NF14703_low_7
Description: NF14703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14703_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 136 - 284
Target Start/End: Original strand, 43484044 - 43484192
Alignment:
| Q |
136 |
gttatgcgcagcaagagtattaaaagaaataaacaaccaaactagtgagggtatcaacaaagctcaacaacataaggaagtacatgctgacatgtttaag |
235 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43484044 |
gttatgcgcagcaagagtattgaaagaaataaacaaccaaagtagtgagggtgtcaacaaagctcaacaacataaggaagtacatgctgacatgtttaag |
43484143 |
T |
 |
| Q |
236 |
ctaaaagaaggaggagataacgttggttctgatgttttcaccatggatt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43484144 |
ctaaaagaaggaggagataacgttggttctgatgttttcaccatggatt |
43484192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 43483910 - 43484004
Alignment:
| Q |
1 |
tgatttttgttctcctttgcttcttctccatccatattcaagttaaaggtaccttttgcttcaaatattacaatattggattaagaatattccca |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43483910 |
tgatttttgttctcctttgcttcttctccatccatattcaagttaaaggtaccttttgcttcaaatattacaacattggattaagaatattccca |
43484004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University