View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14704_high_14 (Length: 227)
Name: NF14704_high_14
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14704_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 90 - 192
Target Start/End: Original strand, 44351735 - 44351837
Alignment:
| Q |
90 |
aaggtaacccaattcaattgattctccaattgcttgttttaggtttagttagggttttaaaattcggaattggaaaattgctttgtaaatctgtcatccg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44351735 |
aaggtaacccaattcaattgattctccaattgcttgttttaggtttagttagggttttaaaattcgtaattggaaaattgctttgtaaatctgtcatccg |
44351834 |
T |
 |
| Q |
190 |
tga |
192 |
Q |
| |
|
||| |
|
|
| T |
44351835 |
tga |
44351837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 44351640 - 44351693
Alignment:
| Q |
1 |
cgttcctcgcgagtctc--tccccttccccctggtgcttctcagctgctgcctg |
52 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44351640 |
cgttcctcgcgagtctctctccccttccccctggtgcttctcagctgctgcctg |
44351693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 9682759 - 9682647
Alignment:
| Q |
104 |
caattgattctccaattgcttgttttaggtttagttagggttttaaaattcggaattggaaaattgctttgtaaatctgtcatccgtgatattaattatg |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||| ||||| ||||||| ||||||||||||||||||| ||||| || ||||||||| || |
|
|
| T |
9682759 |
caattcattctccaattgcttgttttaggtttag----ggttttcaaatttggaattg-aaaattgctttgtaaatctctcatctgtcatattaattctg |
9682665 |
T |
 |
| Q |
204 |
ataaataagtcaaatttg |
221 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
9682664 |
ataaataacccaaatttg |
9682647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 138 - 221
Target Start/End: Original strand, 28213383 - 28213459
Alignment:
| Q |
138 |
ttagggttttaaaattcggaattggaaaattgctttgtaaatctgtcatccgtgatattaattatgataaataagtcaaatttg |
221 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
28213383 |
ttagggttttagaattgggaattggaaaattgctttgtaaatct-------gtgatattaattatgataattaagccaaatttg |
28213459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 179
Target Start/End: Complemental strand, 2388443 - 2388406
Alignment:
| Q |
142 |
ggttttaaaattcggaattggaaaattgctttgtaaat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2388443 |
ggttttaaaattcggaattggaaaattgctttgtaaat |
2388406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 144 - 220
Target Start/End: Complemental strand, 12700542 - 12700466
Alignment:
| Q |
144 |
ttttaaaattcggaattggaaaattgctttgtaaatctgtcatccgtgatattaattatgataaataagtcaaattt |
220 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||| ||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
12700542 |
ttttagaattgggaattggaaaattgctttgtaaatttgtcatctgtcatattaattatgataaataacccaaattt |
12700466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 220
Target Start/End: Complemental strand, 12761552 - 12761497
Alignment:
| Q |
165 |
aattgctttgtaaatctgtcatccgtgatattaattatgataaataagtcaaattt |
220 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
12761552 |
aattgctttgtaaatttgtcatctgtcatattaattatgataaataacccaaattt |
12761497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 12761620 - 12761587
Alignment:
| Q |
19 |
ccccttccccctggtgcttctcagctgctgcctg |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
12761620 |
cccctgccccctggtgcttctcagctgctgcctg |
12761587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University