View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14704_high_16 (Length: 217)

Name: NF14704_high_16
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14704_high_16
NF14704_high_16
[»] chr3 (1 HSPs)
chr3 (1-217)||(8821864-8822080)


Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 8822080 - 8821864
Alignment:
1 gattgggttaagtgattttgttggggtttgcatgggtttatatatatgaggtgagtgacgaaattgccccttgtgtgggtattattgcgctctgtgtttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8822080 gattgggttaagtgattttgttggggtttgcatgggtttatatatatgaggtgagtgacgaaattgccccttgtgtgggtattattgcgctctgtgtttt 8821981  T
101 actgtcattaaccatgtggtgttgccggtgcttgacatggtggggtaacattttcaatatgacgttagtactattttaaaatttcaataannnnnnnggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||    
8821980 actgtcattaaccatgtggtgttgccggtgcttgacatggtggggtaacattttcaatatgacgttagtactattttaaaatttcaataatttttttggt 8821881  T
201 acaattttcaaaatttc 217  Q
    |||||||||||||||||    
8821880 acaattttcaaaatttc 8821864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University