View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14704_low_17 (Length: 273)
Name: NF14704_low_17
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14704_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 12 - 146
Target Start/End: Original strand, 41008362 - 41008495
Alignment:
| Q |
12 |
atgtcaaagaattttttctaacttaactaaagattttggattataattcagttatgaaactacaacaatactaaaccgaaagagatttgtcactcattat |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41008362 |
atgtcaaagaatttt-tctaacttaactaaagattttgggttataattcagttataaaactacaacaatactaaaccgaaagagatttgtcactcattat |
41008460 |
T |
|
| Q |
112 |
gactcaacccacaatactaaagggaaaaagatttg |
146 |
Q |
| |
|
| |||||| |||||||||||||||||| ||||||| |
|
|
| T |
41008461 |
ggctcaactcacaatactaaagggaaagagatttg |
41008495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 212 - 249
Target Start/End: Original strand, 41008492 - 41008529
Alignment:
| Q |
212 |
tttggcataaataaatccacaataaaacagaagaaaca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41008492 |
tttggcataaataaatccacaataaaacagaagaaaca |
41008529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University