View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14704_low_20 (Length: 250)
Name: NF14704_low_20
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14704_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 128 - 249
Target Start/End: Original strand, 44351534 - 44351658
Alignment:
| Q |
128 |
ctgaggcagcagcaaacaagttgaatcagaaacttgaaattgtagcagtgcgaaattcatcatacacaatatgtgaa---gaattagaacaactcttctt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
44351534 |
ctgaggcagcagcaaacaagttgaatcagaaacttgaaattgtagcagtgcgaaattcatcatacacaatatgtgaagttgaatcagaacaactcttctt |
44351633 |
T |
|
| Q |
225 |
ctctctcgttcctcgcgagtctctc |
249 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44351634 |
ctctctcgttcctcgcgagtctctc |
44351658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 7909614 - 7909671
Alignment:
| Q |
192 |
cacaatatgtgaagaattagaacaactcttcttctctctcgttcctcgcgagtctctc |
249 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7909614 |
cacaatatctgaagaatcagaacaactcttcttctctctcgtccctcgcgagtctctc |
7909671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 9682925 - 9682867
Alignment:
| Q |
191 |
acacaatatgtgaagaattagaacaactcttcttctctctcgttcctcgcgagtctctc |
249 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
9682925 |
acactatatgtgaagaatcagaacaactcttcttctctctcgtcccttgcgagtctctc |
9682867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University