View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14704_low_23 (Length: 234)
Name: NF14704_low_23
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14704_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 4 - 130
Target Start/End: Original strand, 43108906 - 43109032
Alignment:
| Q |
4 |
ccaatccaaaggtaaccgcgggtgggaatatagcacccatctccgtccgtttaagcttgcggtttatttcggtgtcggtctcgtcggttgacggtttatt |
103 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43108906 |
ccaatccgaaggtaactgcgggtgggaatatagcacccatctccgtccgtttaagcttgtggtttatttcggtgtcggtctcgtcggttgacggtttatt |
43109005 |
T |
|
| Q |
104 |
cggacggtttcttcggatatttcaaag |
130 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
43109006 |
cggacagtttcttcggatatttcaaag |
43109032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 19533150 - 19533252
Alignment:
| Q |
4 |
ccaatccaaaggtaaccgcgggtgggaatatagcacccatctccgtccgtttaagcttgcggtttatttcggtgtcggtctcgtcggttgacggtttatt |
103 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19533150 |
ccaatccgaaggtaaccgcgggtgggaatatagcacccatctccgtctgtt-aagcttgcggtttatttcggtgtcggtctcgtcggttgacggtttctt |
19533248 |
T |
|
| Q |
104 |
cgga |
107 |
Q |
| |
|
|||| |
|
|
| T |
19533249 |
cgga |
19533252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 17 - 138
Target Start/End: Original strand, 24214397 - 24214518
Alignment:
| Q |
17 |
aaccgcgggtgggaatatagcacccatctccgtccgtttaagcttgcggtttatttcggtgtcggtctcgtcggttgacggtttattcggacggtttctt |
116 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| ||||| | |||||| ||||| | |||||||||| ||||| ||||||||||| || |
|
|
| T |
24214397 |
aaccgcgggtgggaatatatcacccatttccgtccgtttaagctaacggttaacttcggtatcggttttgtcggttgacagtttactcggacggtttttt |
24214496 |
T |
|
| Q |
117 |
cggatatttcaaagcctcaaaa |
138 |
Q |
| |
|
||||| |||||||||| |||| |
|
|
| T |
24214497 |
cggattcttcaaagcctaaaaa |
24214518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 19533325 - 19533368
Alignment:
| Q |
177 |
ctgagaagaaaaaataaacatggagagagaatggaagtacattt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19533325 |
ctgagaagaaaaaataaacatggagagagaatggaagtacattt |
19533368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 144
Target Start/End: Original strand, 40158515 - 40158642
Alignment:
| Q |
17 |
aaccgcgggtgggaatatagcacccatctccgtccgtttaagcttgcggtttatttcggtgtcggtctcgtcggttgacggtttattcggacggtttctt |
116 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| ||||| | |||||| ||||| | |||||||||||||||| ||||||||||| || |
|
|
| T |
40158515 |
aaccgcgggtgggaatatatcacccatttccgtccgtttaagctaacggttaacttcggtatcggttttgtcggttgacggtttactcggacggtttttt |
40158614 |
T |
|
| Q |
117 |
cggatatttcaaagcctcaaaatcaaag |
144 |
Q |
| |
|
||||| |||||||||| |||| ||||| |
|
|
| T |
40158615 |
cggattcttcaaagcctaaaaaacaaag |
40158642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University