View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14704_low_25 (Length: 226)
Name: NF14704_low_25
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14704_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 10068785 - 10068576
Alignment:
| Q |
1 |
tatgttcatatggatttttaattggattttgtaatattattgtggttatttgttatgattaatgaattcattcatgccctcttctttggttaaatatatt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10068785 |
tatgttcatatgggtttttaattggattttgtaatattattgtgattatttgttatgattaatgaattcattcatgccctcttctttggttaaatatatt |
10068686 |
T |
|
| Q |
101 |
ctccttttatcttcctgtttatgtagtttttaaaaaggcttaattcaatttctcattcaaaatctaatcatgaacatgtagaaattgaaat-ggaatggg |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
10068685 |
ctccttttatcttcttgtttatgtagtttttaaaaaggc-taatccaatttctcattcaaaatctaatcatgaacatgtagaaattgaaatgggaatagg |
10068587 |
T |
|
| Q |
200 |
catgggaaagt |
210 |
Q |
| |
|
||||||||||| |
|
|
| T |
10068586 |
catgggaaagt |
10068576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 169
Target Start/End: Complemental strand, 10075390 - 10075272
Alignment:
| Q |
54 |
tatgattaatgaattcattcatgccctcttctttggtta------aatatattctccttttatcttcctgtttatgtagtttttaaaaaggcttaattca |
147 |
Q |
| |
|
|||| ||||||||||||| ||| |||| ||||||||| | ||| ||||||| | || ||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
10075390 |
tatggttaatgaattcatccatacccttttctttggtaattacacaatgtattctcttattctcttcttgtttatgatgtttttaa---ggcttaattca |
10075294 |
T |
|
| Q |
148 |
atttctcattcaaaatctaatc |
169 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
10075293 |
atttctcattccaaatctaatc |
10075272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 10106510 - 10106473
Alignment:
| Q |
7 |
catatggatttttaattggattttgtaatattattgtg |
44 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10106510 |
catatgggtttttaattggattatgtaatattattgtg |
10106473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University