View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14704_low_26 (Length: 217)
Name: NF14704_low_26
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14704_low_26 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 8822080 - 8821864
Alignment:
| Q |
1 |
gattgggttaagtgattttgttggggtttgcatgggtttatatatatgaggtgagtgacgaaattgccccttgtgtgggtattattgcgctctgtgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8822080 |
gattgggttaagtgattttgttggggtttgcatgggtttatatatatgaggtgagtgacgaaattgccccttgtgtgggtattattgcgctctgtgtttt |
8821981 |
T |
 |
| Q |
101 |
actgtcattaaccatgtggtgttgccggtgcttgacatggtggggtaacattttcaatatgacgttagtactattttaaaatttcaataannnnnnnggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8821980 |
actgtcattaaccatgtggtgttgccggtgcttgacatggtggggtaacattttcaatatgacgttagtactattttaaaatttcaataatttttttggt |
8821881 |
T |
 |
| Q |
201 |
acaattttcaaaatttc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8821880 |
acaattttcaaaatttc |
8821864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University