View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_high_14 (Length: 297)
Name: NF14705_high_14
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 284
Target Start/End: Complemental strand, 24220876 - 24220604
Alignment:
| Q |
12 |
aagcaaaggggagctggatggagtaggaaaatatatgcttagttgcgttggaggaactgtagcggtgtagaggtacgaaagcactgattgaggacgcctt |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
24220876 |
aagctaaggggagctggatggagtaggaaaatatacgcttagttgcgttggaggaactgtagcggtgtagaggtacgaaagcactgattggggccgcctt |
24220777 |
T |
 |
| Q |
112 |
ttaattcattgtggtagcagctgcagataacatgcatagggcatgttgcttggttctacttctggtttataggaagacggcagcattaatacatggtaaa |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24220776 |
ttaattcatagtggtagcagctgcagataacatgcatagggcatgttgcttggttctgcttctggtttataggaagatggcagcattaatacatggtaaa |
24220677 |
T |
 |
| Q |
212 |
tttgagacatatggagcatgttggcttttcatcacaccaggtttttggaatttcattggtgtgtggtaagtga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
24220676 |
tttgagacatatggagcatgttggcttttcatcacaccaggtgtttggaatttcattgtcgtgtggtaagtga |
24220604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University