View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_high_15 (Length: 294)
Name: NF14705_high_15
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 25 - 283
Target Start/End: Complemental strand, 14003512 - 14003254
Alignment:
| Q |
25 |
gatctgctctctatcaaccttggtaattgtcgcttgcgcagagtttccactttctttgctctcattaccaactgtccttcacttaccgagatcaatatga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003512 |
gatctgctctctatcaaccttggtaattgtcgcttgctcacagtttccactttctttgctctcattaccaactgtccttcacttaccgagatcaatatga |
14003413 |
T |
|
| Q |
125 |
atcgcacaaatatccagggaaccaccatacctaattctctgatggatcgtcttgtaaaccctcaattcaagtctctctttctggctagcacttgtttaca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003412 |
atcgcacaaatatccagggaaccaccatacctaattctctgatggatcgtcttgtaaaccctcaattcaagtctctctttctggctagcacttgtttaca |
14003313 |
T |
|
| Q |
225 |
agatcaaaatatcatcatgtttgctgcccttttccccaatctgcagcagcttcatctca |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003312 |
agatcaaaatatcatcatgtttgctgcccttttccccaatctgcagcagcttcatctca |
14003254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 25 - 283
Target Start/End: Original strand, 5767292 - 5767553
Alignment:
| Q |
25 |
gatctgctctctatcaaccttggtaattgtcgcttgcgcagagtttccactttctttgctctcattaccaactgtccttcacttaccgagatcaatatga |
124 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5767292 |
gatctgctctctctcaaccttggtaattgtcgcttgctcacagtttccactttctttgctctcattaccaactgtccttcacttaccgagatcaatatga |
5767391 |
T |
|
| Q |
125 |
atcgcacaaatatccagggaaccaccatacctaattctctgatggatcgtcttgtaaaccctcaattcaagtctctctttctggctag---cacttgttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
5767392 |
atcgcacaaatatccagggaaccaccatacctaattctctgatggatcgtcttgtaaaccctcaattcaagtctctctttctggctagcgccgcttgttt |
5767491 |
T |
|
| Q |
222 |
acaagatcaaaatatcatcatgtttgctgcccttttccccaatctgcagcagcttcatctca |
283 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5767492 |
agaagatcaaaatatcatcatgtttgctgcccttttccccaatctgcagcagcttcatctca |
5767553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University