View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_high_18 (Length: 271)
Name: NF14705_high_18
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 142 - 256
Target Start/End: Original strand, 19891711 - 19891829
Alignment:
| Q |
142 |
tctaaactttgtgcatttcaacatatcctctgtctttgtttatgtcaatgatttgaa----tgcataattttttggatagtccgttttcttgttattttg |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
19891711 |
tctaaactttatgcatttcaacatatcctctgtctttgtttatgtcaatgatttgaagttgtgcataatcttttagatagtccgttttcttgttattttg |
19891810 |
T |
|
| Q |
238 |
attacagtgaactgcaatt |
256 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
19891811 |
attatagtgaactgcaatt |
19891829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University