View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_high_20 (Length: 263)
Name: NF14705_high_20
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 43557100 - 43557169
Alignment:
| Q |
177 |
ttttggttccagaagtaatttattgctatataaaaggtgcttgaaacattgaggaattagagtataacac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43557100 |
ttttggttccagaagtaatttattgctatataaaaggtgcttgaaacattgaggaattagagtataacac |
43557169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University