View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_high_23 (Length: 252)
Name: NF14705_high_23
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 12811742 - 12811542
Alignment:
| Q |
19 |
agagggaccacaagggtgacccaacttcatgtgtccttctaatgtcaattcagtactcacttacctacaacaagcaattcacatgtctgcatgtgtattc |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12811742 |
agagggaccacaagggtgacccagcttcatgtgtccttctaatgtcaattcagcactcacttacctacaacaagcaattcacatgtctgcatgtgtgttc |
12811643 |
T |
 |
| Q |
119 |
tccatcctttctatttgttattcttatttgcactaattttcagtagggtaatgtttcatggacatttatttatccgtttacacttggggtggtttttaca |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12811642 |
tccatcgtttctatttgttattcttatttgcactaattttcagtagggtaatgtttgatggacattcatttatccgtttacacttggggtggtttttaca |
12811543 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
12811542 |
t |
12811542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University