View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_low_15 (Length: 326)
Name: NF14705_low_15
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 309
Target Start/End: Original strand, 19791121 - 19791416
Alignment:
| Q |
14 |
gatgaaggaatgttggctgatgattgcagaagagaatcttgcggcggttgtgaggagtcggcccgtggtgattgttgctgtggaagtcgttcttcaacca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19791121 |
gatgaaggaatgttggctgatgattgcagaagagagtcttgcggcggttgtgaggagtcggcccgtggtgattgttgctgtggaagtcgttcttcaacca |
19791220 |
T |
 |
| Q |
114 |
ctgctttgccctttggatccatagcggtttctcactcacaatcacacaacagcactgacacaacttaatggtttcttgcagacaaagttagaaaacattc |
213 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
19791221 |
ctgctttgccctttgggtccatggcggtttctgactcacaatcacacaacagcactgatactacttaatggtttcttgcagagaaagtttgaaaatattc |
19791320 |
T |
 |
| Q |
214 |
tggtgttactaactgactaacggttttattgatagttggttatttaaccagttgcataaccaactaacggttctcctacctagctgagtaaaggat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
19791321 |
tggtgttactaactgactaacggttttattgatagttggttatttaaccagttgcataaccgactaacggttctcctaactagctgagtaaaggat |
19791416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 250
Target Start/End: Original strand, 19589926 - 19590034
Alignment:
| Q |
139 |
ggtttctcactcacaatcacacaacagcactgacacaacttaatggtttcttgcagacaaagttagaaaacattctggtgttactaactgactaacggtt |
238 |
Q |
| |
|
||||||| ||||||||||||| | |||| || ||||||||||||||| || || ||| ||| |||| |||||| | ||||||||| |||||||||| |
|
|
| T |
19589926 |
ggtttctgactcacaatcacaaa---gcaccgatacaacttaatggtttatttgaggaaaatttataaaatattctgatattactaactcactaacggtt |
19590022 |
T |
 |
| Q |
239 |
ttattgatagtt |
250 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19590023 |
ttattgatagtt |
19590034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 19584135 - 19584102
Alignment:
| Q |
125 |
tttggatccatagcggtttctcactcacaatcac |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
19584135 |
tttggatccatagcggtttctgactcacaatcac |
19584102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University