View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14705_low_15 (Length: 326)

Name: NF14705_low_15
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14705_low_15
NF14705_low_15
[»] chr5 (3 HSPs)
chr5 (14-309)||(19791121-19791416)
chr5 (139-250)||(19589926-19590034)
chr5 (125-158)||(19584102-19584135)


Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 309
Target Start/End: Original strand, 19791121 - 19791416
Alignment:
14 gatgaaggaatgttggctgatgattgcagaagagaatcttgcggcggttgtgaggagtcggcccgtggtgattgttgctgtggaagtcgttcttcaacca 113  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19791121 gatgaaggaatgttggctgatgattgcagaagagagtcttgcggcggttgtgaggagtcggcccgtggtgattgttgctgtggaagtcgttcttcaacca 19791220  T
114 ctgctttgccctttggatccatagcggtttctcactcacaatcacacaacagcactgacacaacttaatggtttcttgcagacaaagttagaaaacattc 213  Q
    |||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||| |||||| ||||| ||||    
19791221 ctgctttgccctttgggtccatggcggtttctgactcacaatcacacaacagcactgatactacttaatggtttcttgcagagaaagtttgaaaatattc 19791320  T
214 tggtgttactaactgactaacggttttattgatagttggttatttaaccagttgcataaccaactaacggttctcctacctagctgagtaaaggat 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||    
19791321 tggtgttactaactgactaacggttttattgatagttggttatttaaccagttgcataaccgactaacggttctcctaactagctgagtaaaggat 19791416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 250
Target Start/End: Original strand, 19589926 - 19590034
Alignment:
139 ggtttctcactcacaatcacacaacagcactgacacaacttaatggtttcttgcagacaaagttagaaaacattctggtgttactaactgactaacggtt 238  Q
    ||||||| ||||||||||||| |   |||| || ||||||||||||||| ||  ||  ||| ||| |||| |||||| | ||||||||| ||||||||||    
19589926 ggtttctgactcacaatcacaaa---gcaccgatacaacttaatggtttatttgaggaaaatttataaaatattctgatattactaactcactaacggtt 19590022  T
239 ttattgatagtt 250  Q
    ||||||||||||    
19590023 ttattgatagtt 19590034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 19584135 - 19584102
Alignment:
125 tttggatccatagcggtttctcactcacaatcac 158  Q
    ||||||||||||||||||||| ||||||||||||    
19584135 tttggatccatagcggtttctgactcacaatcac 19584102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University