View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_low_22 (Length: 271)
Name: NF14705_low_22
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 32 - 132
Target Start/End: Complemental strand, 35242387 - 35242287
Alignment:
| Q |
32 |
attatactccttgcactactattcatttttcttataatatggataatttagcttgtgtgtaattgttctgtgaaggatacataagtttctcctgttctac |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35242387 |
attatactccttgcactactattcatttttcttataatatggataatttagcttgtgtgtaattgttctgtgaaggatacataagtttctactgttctac |
35242288 |
T |
|
| Q |
132 |
a |
132 |
Q |
| |
|
| |
|
|
| T |
35242287 |
a |
35242287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 253
Target Start/End: Complemental strand, 35242208 - 35242169
Alignment:
| Q |
214 |
actgtgctttcagaatttgataaacaaccacatggattgt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35242208 |
actgtgctttcagaatttgataaacaaccacatggattgt |
35242169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 253
Target Start/End: Complemental strand, 35247833 - 35247794
Alignment:
| Q |
214 |
actgtgctttcagaatttgataaacaaccacatggattgt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35247833 |
actgtgctttcagaatttgataaacaaccacatggattgt |
35247794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 253
Target Start/End: Complemental strand, 35254355 - 35254316
Alignment:
| Q |
214 |
actgtgctttcagaatttgataaacaaccacatggattgt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254355 |
actgtgctttcagaatttgataaacaaccacatggattgt |
35254316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University