View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_low_29 (Length: 242)
Name: NF14705_low_29
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_low_29 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 66 - 242
Target Start/End: Complemental strand, 28376301 - 28376127
Alignment:
| Q |
66 |
aaaaactattggcataacattaaatattttatgtagattgtacaaaaatttaatgaattgtcgatcaaaacttgtaaaagttttttcgataagagataac |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28376301 |
aaaaactattggcataacattaaatattttatgtagattgtacaaaaatttaatgaattgtcgatcaaaacttgtaatagttttttcgataagagataac |
28376202 |
T |
|
| Q |
166 |
acatcttcaaaactaaatattaaaagttattctcatatatttcaattctttcaactggaaaccttaagcttcatatc |
242 |
Q |
| |
|
|||||||| |||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28376201 |
acatcttc-aaactaaatatt-atagttattctcatatatttcaattctttcaagtggaaaccttaagcttcatatc |
28376127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University