View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_low_34 (Length: 231)
Name: NF14705_low_34
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 5462055 - 5461870
Alignment:
| Q |
16 |
aaaatacatatattactcttctaagttcattcttttggtattaatttgtccaacaacnnnnnnnnnngagtcaaacaacatttcaaatattgaaaaagtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
5462055 |
aaaatacatatattactcttctaagttcattcttttggtattaatttgtccaacaactttttttttagagtcaaa------------tattgaaaaagtt |
5461968 |
T |
 |
| Q |
116 |
gaattaaagacgtaacttcagagatatatata--aaaattgtttccaattttttctctaaatgttaaaaatatgaaaattaagggctaaatgaacttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461967 |
gaattaaagacgtaacttcagagatatatatataaaaattgtttccaattttttctctaaatgttaaaaatatgaaaattaagggctaaatgaacttg |
5461870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University