View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14705_low_37 (Length: 219)
Name: NF14705_low_37
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14705_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 74 - 198
Target Start/End: Original strand, 36642184 - 36642308
Alignment:
| Q |
74 |
acattagcgtctcctctctagacctaacatgaggcatgtgttcctcaaaggatatctcatggttatgagttataacctggctgatgatacatctaatgtg |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36642184 |
acattagcgtctcctcgctagacctaacatgaggcatgtgttcctcaaaggatatctcatggttatgagttataacctggctgatgatacatctaatgtg |
36642283 |
T |
|
| Q |
174 |
gttgataagatggacaacctgatga |
198 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
36642284 |
gttgatgagatggacaacctgatga |
36642308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 147
Target Start/End: Complemental strand, 36651270 - 36651231
Alignment:
| Q |
108 |
catgtgttcctcaaaggatatctcatggttatgagttata |
147 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
36651270 |
catgtgttcctcaagggatatctaatggttatgagttata |
36651231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University