View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_high_16 (Length: 317)
Name: NF14706_high_16
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 100 - 301
Target Start/End: Complemental strand, 5346879 - 5346679
Alignment:
| Q |
100 |
caatggtatgacattatataagtagaaaggacaataaaattaaaatgaaacaataattatatggctctcgtatgacataataacctagtttatcctcaca |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5346879 |
caatggtatgacatgatataagtagaaaggacaataaaattaaaatgaaacaataattatatggctctcgtatgacataataacctagtttatcctcaca |
5346780 |
T |
 |
| Q |
200 |
ctatactttagatttctcattcagacaacttttatcannnnnnnnnaagtacactggtaatgaatgtttaaaatttctttatcaatgattttacaatgat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5346779 |
ctatactttagatttctcattcagacaacttttatca-ttttttttaagtacactggtaatgaatgtttaaaatttctttatcgatgattttacaatgat |
5346681 |
T |
 |
| Q |
300 |
at |
301 |
Q |
| |
|
|| |
|
|
| T |
5346680 |
at |
5346679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University